| Total Complexity | 249 |
| Total Lines | 1371 |
| Duplicated Lines | 2.63 % |
| Changes | 0 | ||
Duplicate code is one of the most pungent code smells. A rule that is often used is to re-structure code once it is duplicated in three or more places.
Common duplication problems, and corresponding solutions are:
Complex classes like build.rna_tools.tools.rna_alignment.rna_alignment often do a lot of different things. To break such a class down, we need to identify a cohesive component within that class. A common approach to find such a component is to look for fields/methods that share the same prefixes, or suffixes.
Once you have determined the fields that belong together, you can apply the Extract Class refactoring. If the component makes sense as a sub-class, Extract Subclass is also a candidate, and is often faster.
| 1 | #!/usr/bin/env python2 |
||
| 2 | """RNAalignment - a module to work with RNA sequence alignments. |
||
| 3 | |||
| 4 | To see a full demo what you can do with this util, please take a look at the jupiter notebook (https://github.com/mmagnus/rna-pdb-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb) |
||
| 5 | |||
| 6 | Load an alignment in the Stockholm:: |
||
| 7 | |||
| 8 | alignment = ra.RNAalignment('test_data/RF00167.stockholm.sto') |
||
| 9 | |||
| 10 | or fasta format:: |
||
| 11 | |||
| 12 | import rna_alignment as ra |
||
| 13 | alignment = ra.fasta2stokholm(alignment.fasta) |
||
| 14 | alignment = ra.RNAalignment |
||
| 15 | |||
| 16 | Parameters of the aligmnent:: |
||
| 17 | |||
| 18 | print(alignment.describe()) |
||
| 19 | |||
| 20 | Consensus SS:: |
||
| 21 | |||
| 22 | print(alignment.ss_cons_with_pk) |
||
| 23 | |||
| 24 | Get sequnce/s from teh aligment:: |
||
| 25 | |||
| 26 | >>> seq = a.io[0] |
||
| 27 | |||
| 28 | """ |
||
| 29 | |||
| 30 | from Bio import AlignIO |
||
| 31 | from Bio.Phylo.TreeConstruction import DistanceCalculator |
||
| 32 | from rna_tools import SecondaryStructure |
||
| 33 | from rna_tools.rna_tools_config import RCHIE_PATH |
||
| 34 | from collections import OrderedDict |
||
| 35 | |||
| 36 | import tempfile |
||
| 37 | import subprocess |
||
| 38 | import os |
||
| 39 | import shutil |
||
| 40 | import re |
||
| 41 | import gzip |
||
| 42 | |||
| 43 | |||
| 44 | class RNAalignmentError(Exception): |
||
| 45 | pass |
||
| 46 | |||
| 47 | |||
| 48 | class RChieError(Exception): |
||
| 49 | pass |
||
| 50 | |||
| 51 | |||
| 52 | class RFAMFetchError(Exception): |
||
| 53 | pass |
||
| 54 | |||
| 55 | |||
| 56 | class RChie: |
||
| 57 | """RChie - plotting arc diagrams of RNA secondary structures. |
||
| 58 | |||
| 59 | .. image:: ../pngs/rchie.png |
||
| 60 | |||
| 61 | http://www.e-rna.org/r-chie/ |
||
| 62 | |||
| 63 | The offline version of R-chie, which requires first installing R4RNA is available here, or clone our git repository here |
||
| 64 | How to install it: |
||
| 65 | |||
| 66 | - Ensure R is installed already, or download it freely from http://www.r-project.org/ |
||
| 67 | - Download the R4RNA (https://github.com/jujubix/r-chie), open R and install the package:: |
||
| 68 | |||
| 69 | install.packages("<path_to_file>/R4RNA", repos = NULL, type="source") |
||
| 70 | # Install the optparse and RColorBrewer |
||
| 71 | install.packages('optparse') |
||
| 72 | install.packages('RColorBrewer') |
||
| 73 | |||
| 74 | - Go to rna_tools/rna_tools_config_local.py and set RCHIE_PATH to the folder with RChie, e.g. ``"/home/magnus/work/opt/r-chie/"``. |
||
| 75 | |||
| 76 | To test if Rchie works on your machine (from rna_align folder):: |
||
| 77 | |||
| 78 | <path to your rchie>/rchie.R --msafile test_data/rchie_test_files/fasta.txt test_data/rchie_test_files/helix.txt |
||
| 79 | |||
| 80 | you should have rchie.png file in the folder. |
||
| 81 | |||
| 82 | More at http://www.e-rna.org/r-chie/download.cgi |
||
| 83 | |||
| 84 | Cite: Daniel Lai, Jeff R. Proctor, Jing Yun A. Zhu, and Irmtraud M. Meyer (2012) R-chie: a web server and R package for visualizing RNA secondary structures. Nucleic Acids Research, first published online March 19, 2012. doi:10.1093/nar/gks241 |
||
| 85 | """ |
||
| 86 | |||
| 87 | def __init__(self): |
||
| 88 | pass |
||
| 89 | |||
| 90 | def plot_cov(self, seqs, ss_cons, plot_fn='rchie.png', verbose=False): |
||
| 91 | """Plot an RChie plot_conv. |
||
| 92 | |||
| 93 | :param seqs: seqs in the fasta format |
||
| 94 | :param ss_cons: a string of secondary structure consensus, use only ``().``. Works with pseuoknots. |
||
| 95 | """ |
||
| 96 | fasta_alignment = tempfile.NamedTemporaryFile(delete=False) |
||
| 97 | with open(fasta_alignment.name, 'w') as f: |
||
| 98 | f.write(seqs) |
||
| 99 | |||
| 100 | plot = tempfile.NamedTemporaryFile(delete=False) |
||
| 101 | plot.name += '.png' |
||
| 102 | ss = tempfile.NamedTemporaryFile(delete=False) |
||
| 103 | with open(ss.name, 'w') as f: |
||
| 104 | f.write(ss_cons) |
||
| 105 | if not RCHIE_PATH: |
||
| 106 | raise RChieError('RChie path not set up!') |
||
| 107 | cmd = RCHIE_PATH + \ |
||
| 108 | "rchie.R --msafile='%s' --format1 vienna '%s' --output '%s'" % ( |
||
| 109 | fasta_alignment.name, ss.name, plot.name) |
||
| 110 | if verbose: |
||
| 111 | print(cmd) |
||
| 112 | o = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) |
||
| 113 | out = o.stdout.read().strip() |
||
| 114 | err = o.stderr.read().strip() |
||
| 115 | # *****PROCESSING MSA FILE***** |
||
| 116 | # Error in readFasta(opt$msafile, filter = TRUE) : no FASTA sequences found |
||
| 117 | # Error: ERROR: Invalid FASTA file |
||
| 118 | # Execution halted |
||
| 119 | if "error" in str(err).lower(): |
||
| 120 | raise Exception('\n'.join([cmd, err])) |
||
| 121 | if verbose: |
||
| 122 | print('\n'.join([cmd, err])) |
||
| 123 | self.plotfn = plot.name |
||
| 124 | if verbose: |
||
| 125 | print(self.plotfn) |
||
| 126 | if plot_fn: |
||
| 127 | shutil.move(plot.name, plot_fn) |
||
| 128 | print('Rchie: plot saved to %s' % plot_fn) |
||
| 129 | from IPython.display import Image |
||
| 130 | return Image(filename=plot_fn) |
||
| 131 | |||
| 132 | def show(self): |
||
| 133 | from IPython.display import Image |
||
| 134 | return Image(filename=self.plotfn) |
||
| 135 | |||
| 136 | def write(self, outfn): |
||
| 137 | shutil.copyfile(self.plotfn, outfn) |
||
| 138 | print('Write to %s' % outfn) |
||
| 139 | |||
| 140 | |||
| 141 | class RNASeq(object): |
||
| 142 | """RNASeq. |
||
| 143 | |||
| 144 | Args: |
||
| 145 | |||
| 146 | id (str) : id of a sequence |
||
| 147 | seq (str) : seq, it be uppercased. |
||
| 148 | ss (str) : secondary structure, default None |
||
| 149 | |||
| 150 | Attributes: |
||
| 151 | |||
| 152 | seq_no_gaps(str) : seq.replace('-', '') |
||
| 153 | ss_no_gaps(str) : ss.replace('-', '') |
||
| 154 | |||
| 155 | .. warning:: |
||
| 156 | |||
| 157 | >>> if 'EF' in s.id: print('Y') |
||
| 158 | Y |
||
| 159 | >>> if 'EF' in s: print('Y') |
||
| 160 | # nothing |
||
| 161 | |||
| 162 | """ |
||
| 163 | |||
| 164 | def __init__(self, id, seq, ss=None): |
||
| 165 | self.id = id |
||
| 166 | self.seq = seq.upper() |
||
| 167 | |||
| 168 | # self.ss_raw = ss # this will not be changed after remove_gaps. |
||
| 169 | # so maybe don't use ss_raw at call |
||
| 170 | self.ss = ss |
||
| 171 | self.ss = self.get_ss_std() |
||
| 172 | |||
| 173 | self.seq_no_gaps = seq.replace('-', '') |
||
| 174 | self.ss_no_gaps = ss.replace('-', '') |
||
| 175 | |||
| 176 | #@property |
||
| 177 | def get_ss_std(self): |
||
| 178 | nss = '' |
||
| 179 | for s in self.ss: |
||
| 180 | nss += get_rfam_ss_notat_to_dot_bracket_notat(s) |
||
| 181 | return nss |
||
| 182 | |||
| 183 | def __repr__(self): |
||
| 184 | return self.id |
||
| 185 | |||
| 186 | def __len__(self): |
||
| 187 | return len(self.seq) |
||
| 188 | |||
| 189 | def __getitem__(self, i): |
||
| 190 | if self.ss: |
||
| 191 | return RNASeq(self.id + '_slice', self.seq[i], self.ss[i]) |
||
| 192 | else: |
||
| 193 | return RNASeq(self.id + '_slice', self.seq[i]) |
||
| 194 | |||
| 195 | def remove_columns(self, to_remove): |
||
| 196 | """indexing from 0""" |
||
| 197 | nseq = '' |
||
| 198 | for i, s in enumerate(self.seq): |
||
| 199 | if i not in to_remove: |
||
| 200 | nseq += s |
||
| 201 | |||
| 202 | nss = '' |
||
| 203 | if self.ss: |
||
| 204 | for i, s in enumerate(self.ss): |
||
| 205 | if i not in to_remove: |
||
| 206 | nss += s |
||
| 207 | self.seq = nseq |
||
| 208 | self.ss = nss |
||
| 209 | |||
| 210 | def draw_ss(self, title='', verbose=False, resolution=1.5): |
||
| 211 | """Draw secondary structure of RNA with VARNA. |
||
| 212 | |||
| 213 | VARNA: Visualization Applet for RNA |
||
| 214 | A Java lightweight component and applet for drawing the RNA secondary structure |
||
| 215 | |||
| 216 | .. image :: ../pngs/varna.png |
||
| 217 | |||
| 218 | Cite: VARNA: Interactive drawing and editing of the RNA secondary structure Kevin Darty, Alain Denise and Yann Ponty Bioinformatics, pp. 1974-197,, Vol. 25, no. 15, 2009 |
||
| 219 | |||
| 220 | http://varna.lri.fr/""" |
||
| 221 | drawfn = tempfile.NamedTemporaryFile(delete=False).name + '.png' |
||
| 222 | SecondaryStructure.draw_ss(title, self.seq, self.ss, drawfn, resolution, verbose=verbose) |
||
| 223 | from IPython.display import Image |
||
| 224 | return Image(filename=drawfn) |
||
| 225 | |||
| 226 | def remove_gaps(self, check_bps=True, only_canonical=True, allow_gu=True): |
||
| 227 | """Remove gaps from seq and secondary structure of the seq. |
||
| 228 | |||
| 229 | Args: |
||
| 230 | |||
| 231 | check_bps (bool) : fix mistakes as |
||
| 232 | only_canonical (bool) : keep in ss only pairs GC, AU |
||
| 233 | allow_gu (bool) : keep in ss also GU pair |
||
| 234 | |||
| 235 | .. image :: ../pngs/ss_misgap.png |
||
| 236 | |||
| 237 | A residue "paired" with a gap. |
||
| 238 | |||
| 239 | .. image :: ../pngs/ss_misgap_wrong.png |
||
| 240 | |||
| 241 | .. when check_bps (by default), then when removing gaps, the functions check is the gap is |
||
| 242 | paired with any residues (in the blue circle). If yes, then this residues is unpair (in this case ``)`` -> ``.``). |
||
| 243 | |||
| 244 | .. image :: ../pngs/ss_misgap_ok.png |
||
| 245 | |||
| 246 | if ``only_canonical`` (by default) is True then only GC, AU can be paired. |
||
| 247 | |||
| 248 | |||
| 249 | .. image :: ../pngs/ss_only_canonical.png |
||
| 250 | |||
| 251 | |||
| 252 | If ``allow_gu`` is False (be default is True) then GU pair is also possible. |
||
| 253 | |||
| 254 | .. image :: ../pngs/ss_no_gu.png |
||
| 255 | |||
| 256 | If you provide seq and secondary structure such as:: |
||
| 257 | |||
| 258 | GgCcGGggG.GcggG.cc.u.aAUACAAuACCC.GaAA.GGGGAAUAaggCc.gGCc.gu......CU.......uugugcgGUuUUcaAgCccCCgGcCaCCcuuuu |
||
| 259 | (((((((((....((.((............(((......)))......))))..(((.(.....................)))).......)))))))))........ |
||
| 260 | |||
| 261 | gaps will be remove as well. |
||
| 262 | """ |
||
| 263 | GAPS = ['-', '.'] |
||
| 264 | |||
| 265 | nseq = '' |
||
| 266 | nss = '' |
||
| 267 | for (nt, nt_ss) in zip(self.seq, self.ss): |
||
| 268 | if nt in GAPS and nt_ss in GAPS: |
||
| 269 | pass |
||
| 270 | else: |
||
| 271 | nseq += nt |
||
| 272 | nss += nt_ss |
||
| 273 | self.seq = nseq |
||
| 274 | self.ss = nss |
||
| 275 | |||
| 276 | nss = list() |
||
| 277 | bps = self.ss_to_bps() |
||
| 278 | |||
| 279 | if check_bps: |
||
| 280 | nss = list(self.ss) |
||
| 281 | for bp in bps: |
||
| 282 | nt_left = self.seq[bp[0]] |
||
| 283 | nt_right = self.seq[bp[1]] |
||
| 284 | if nt_left == '-' or nt_right == '-': |
||
| 285 | nss[bp[0]] = '.' |
||
| 286 | nss[bp[1]] = '.' |
||
| 287 | self.ss = ''.join(nss) |
||
| 288 | |||
| 289 | if only_canonical: |
||
| 290 | nseq = list(self.seq) |
||
| 291 | nss = list(self.ss) |
||
| 292 | for bp in bps: |
||
| 293 | nt_left = nseq[bp[0]] |
||
| 294 | nt_right = nseq[bp[1]] |
||
| 295 | if (nt_left == 'A' and nt_right == 'U') or (nt_left == 'U' and nt_right == 'A'): |
||
| 296 | pass |
||
| 297 | elif (nt_left == 'G' and nt_right == 'C') or (nt_left == 'C' and nt_right == 'G'): |
||
| 298 | pass |
||
| 299 | elif (nt_left == 'G' and nt_right == 'U') or (nt_left == 'U' and nt_right == 'G'): |
||
| 300 | if allow_gu: |
||
| 301 | pass |
||
| 302 | else: |
||
| 303 | nss[bp[0]] = '.' |
||
| 304 | nss[bp[1]] = '.' |
||
| 305 | else: |
||
| 306 | nss[bp[0]] = '.' |
||
| 307 | nss[bp[1]] = '.' |
||
| 308 | self.ss = ''.join(nss) |
||
| 309 | |||
| 310 | # two?????? what is "two"? |
||
| 311 | nss = [] |
||
| 312 | nseq = '' |
||
| 313 | for i, (c, s) in enumerate(zip(self.seq, self.ss)): |
||
| 314 | if c != '-': |
||
| 315 | nseq += c |
||
| 316 | nss.append(s) |
||
| 317 | |||
| 318 | self.seq = nseq |
||
| 319 | self.ss = ''.join(nss) |
||
| 320 | |||
| 321 | def ss_to_bps(self): |
||
| 322 | """Convert secondary structure into a list of basepairs. |
||
| 323 | |||
| 324 | Returns: |
||
| 325 | |||
| 326 | bps (list): a list of base pairs, e.g. [[0, 80], [1, 79], [2, 78], [4, 77], [6, 75], [7, 74], ...] |
||
| 327 | |||
| 328 | """ |
||
| 329 | j = [] |
||
| 330 | bps = [] |
||
| 331 | pair_types = ['()', '[]', '<>', '{}'] |
||
| 332 | for pair_type in pair_types: |
||
| 333 | for i, s in enumerate(self.ss): |
||
| 334 | if s == pair_type[0]: |
||
| 335 | j.append(i) |
||
| 336 | if s == pair_type[1]: |
||
| 337 | bps.append([j.pop(), i]) |
||
| 338 | if len(j): |
||
| 339 | # if something left, this is a problem (!!!) |
||
| 340 | raise Exception('Mis-paired secondary structure') |
||
| 341 | bps.sort() |
||
| 342 | return bps |
||
| 343 | |||
| 344 | def get_conserved(self, consensus, start=0, to_pymol=True, offset=0): |
||
| 345 | """Start |
||
| 346 | UCGGGGUGCCCUUCUGCGUG--------------------------------------------------AAGGC-UGAGAAAUACCCGU-------------------------------------------------AUCACCUG-AUCUGGAU-AAUGC |
||
| 347 | XXXXXXXXXXXXGXGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX----------------------------XXXXX-XCUGAGAXXXXXXXXXXXXXXXXXXXXXX----------------------------------XXXXXXXX-XXXXXXXX-ACXUG |
||
| 348 | """ |
||
| 349 | c = start + offset |
||
| 350 | index = [] |
||
| 351 | print(self.seq) |
||
| 352 | print(consensus) |
||
| 353 | for nt_seq, nt_consensus in zip(self.seq, consensus): |
||
| 354 | if nt_consensus in ['-', 'X']: |
||
| 355 | pass |
||
| 356 | else: |
||
| 357 | index.append(c) |
||
| 358 | if nt_seq != '-': |
||
| 359 | c += 1 |
||
| 360 | if to_pymol: |
||
| 361 | return("color red, " + str(index).replace(', ', '+').replace('[','').replace(']','')) |
||
| 362 | else: |
||
| 363 | return index |
||
| 364 | |||
| 365 | def get_distance_to(self, nseq): |
||
| 366 | """Get distance of self.seq to nseq.""" |
||
| 367 | try: |
||
| 368 | import Levenshtein |
||
| 369 | except: |
||
| 370 | print('pip install python-Levenshtein') |
||
| 371 | return round(Levenshtein.ratio(self.seq, nseq), 2) |
||
| 372 | |||
| 373 | class RNAalignment(object): |
||
| 374 | """RNA alignment - adapter class around BioPython to do RNA alignment stuff |
||
| 375 | |||
| 376 | Usage (for more see IPython notebook https://github.com/mmagnus/rna-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb) |
||
| 377 | |||
| 378 | >>> a = RNAalignment('test_data/RF00167.stockholm.sto') |
||
| 379 | >>> print(a.tail()) |
||
| 380 | >>> print(a.ss_cons) |
||
| 381 | |||
| 382 | Args: |
||
| 383 | |||
| 384 | fn (str): Filename |
||
| 385 | io (Bio.AlignIO): AlignIO.read(fn, "stockholm") |
||
| 386 | lines (list): List of all lines of fn |
||
| 387 | seqs (list): List of all sequences as class:`RNASeq` objects |
||
| 388 | rf (str): ReFerence annotation, the consensus RNA sequence |
||
| 389 | |||
| 390 | Read more: |
||
| 391 | |||
| 392 | - http://biopython.org/DIST/docs/api/Bio.AlignIO.StockholmIO-module.html |
||
| 393 | |||
| 394 | and on the format itself |
||
| 395 | |||
| 396 | - https://en.wikipedia.org/wiki/Stockholm_format |
||
| 397 | - http://sonnhammer.sbc.su.se/Stockholm.html |
||
| 398 | |||
| 399 | .. warning:: fetch requires urllib3 |
||
| 400 | """ |
||
| 401 | |||
| 402 | def __init__(self, fn='', fetch=''): |
||
| 403 | if fetch: |
||
| 404 | import urllib3 |
||
| 405 | http = urllib3.PoolManager() |
||
| 406 | response = http.request('GET', 'http://rfam.xfam.org/family/' + |
||
| 407 | fetch + '/alignment/stockholm?gzip=1&download=1') |
||
| 408 | if not response.status == 200: |
||
| 409 | raise RFAMFetchError( |
||
| 410 | "The alignment could not be downloaded. Please check the RFAM id that you requested! (don't put .stk etc in the id)") |
||
| 411 | with open(fetch + '.stk.gz', 'wb') as f: |
||
| 412 | f.write(response.data) |
||
| 413 | with gzip.open(fetch + '.stk.gz', 'rb') as f: |
||
| 414 | file_content = f.read() |
||
| 415 | with open(fetch + '.stk', 'wb') as f: |
||
| 416 | f.write(file_content) |
||
| 417 | fn = fetch + '.stk' |
||
| 418 | |||
| 419 | self.fn = fn |
||
| 420 | self.lines = open(fn).read().split('\n') |
||
| 421 | self.io = AlignIO.read(fn, "stockholm") |
||
| 422 | self.ss_cons = self.get_ss_cons() |
||
| 423 | self.ss_cons_pk = self.get_ss_cons_pk() |
||
| 424 | self.copy_ss_cons_to_all() |
||
| 425 | self._ss_cons_std = self.ss_cons |
||
| 426 | self.rf = self.get_gc_rf() |
||
| 427 | self.shift = self.get_shift_seq_in_align() |
||
| 428 | |||
| 429 | # get all lines not # nor // |
||
| 430 | # fix for blocked alignment |
||
| 431 | seq_lines = [l for l in self.lines if ( |
||
| 432 | not l.startswith('#')) and (not l.startswith('//')) and (l)] |
||
| 433 | seqs_dict = OrderedDict() |
||
| 434 | for seq in seq_lines: |
||
| 435 | seq_id, seq_seq = seq.split() |
||
| 436 | if seq_id not in seqs_dict: |
||
| 437 | seqs_dict[seq_id] = seq_seq |
||
| 438 | else: |
||
| 439 | seqs_dict[seq_id] += seq_seq |
||
| 440 | self.seqs = [] |
||
| 441 | for seq in seqs_dict: |
||
| 442 | self.seqs.append(RNASeq(seq, seqs_dict[seq], ss=self.ss_cons_with_pk_std)) |
||
| 443 | |||
| 444 | # this is sick! |
||
| 445 | # I create a Cols object to be able to slice alignments |
||
| 446 | class Cols: |
||
| 447 | def __init__(self, alignment): |
||
| 448 | self.alignment = alignment |
||
| 449 | |||
| 450 | def __getitem__(self, i): |
||
| 451 | """Return new alignment""" |
||
| 452 | if type(i) is list: |
||
| 453 | pass |
||
| 454 | else: |
||
| 455 | # collect "new" sequences |
||
| 456 | n_seqs = [] |
||
| 457 | for s in self.alignment: |
||
| 458 | new_seq = RNASeq(s.id, s.seq[i], s.ss[i]) |
||
| 459 | n_seqs.append(new_seq) |
||
| 460 | |||
| 461 | # this is not very smart :( |
||
| 462 | # save new seqs to a file |
||
| 463 | # and load it as RNAalignment |
||
| 464 | tf = tempfile.NamedTemporaryFile(delete=False) |
||
| 465 | tf.name += '.stk' |
||
| 466 | with open(tf.name, 'w') as f: |
||
| 467 | f.write('# STOCKHOLM 1.0\n') |
||
| 468 | for s in n_seqs: |
||
| 469 | f.write(' '.join([s.id, s.seq, '\n'])) |
||
| 470 | # add ss_cons & // |
||
| 471 | f.write('#=GC SS_cons ' + self.alignment.ss_cons[i] + '\n') |
||
| 472 | if self.alignment.ss_cons_pk: |
||
| 473 | f.write('#=GC SS_cons_pk' + self.alignment.ss_cons_pk[i] + '\n') |
||
| 474 | f.write('#=GC RF ' + self.alignment.rf[i] + '\n') |
||
| 475 | f.write('//\n') |
||
| 476 | return RNAalignment(tf.name) |
||
| 477 | self.cols = Cols(self) |
||
| 478 | # ^^^^ sick ^^^^^^^^^^^ |
||
| 479 | |||
| 480 | def reload_alignment(self): |
||
| 481 | tmpfn = tempfile.NamedTemporaryFile(delete=False).name |
||
| 482 | self.write(tmpfn) |
||
| 483 | self.io = AlignIO.read(tmpfn, "stockholm") |
||
| 484 | |||
| 485 | def __len__(self): |
||
| 486 | """Return length of all sequenes.""" |
||
| 487 | return len(self.seqs) |
||
| 488 | |||
| 489 | def __getitem__(self, i): |
||
| 490 | if type(i) is str: |
||
| 491 | for s in self: |
||
| 492 | if s.id == i: |
||
| 493 | return s |
||
| 494 | elif type(i) is list: |
||
| 495 | seqs = [] |
||
| 496 | for j in i: |
||
| 497 | seqs.append(self.seqs[j]) |
||
| 498 | return seqs |
||
| 499 | else: |
||
| 500 | return self.seqs[i] |
||
| 501 | |||
| 502 | @property |
||
| 503 | def ss_cons_std(self): |
||
| 504 | return get_rfam_ss_notat_to_dot_bracket_notat(self.ss_cons) |
||
| 505 | |||
| 506 | @ss_cons_std.setter |
||
| 507 | def ss_cons_std(self, ss): |
||
| 508 | self._ss_cons_std = ss |
||
| 509 | print(self._ss_cons_std) |
||
| 510 | |||
| 511 | def subset(self, ids, verbose=False): |
||
| 512 | """Get subset for ids:: |
||
| 513 | |||
| 514 | # STOCKHOLM 1.0 |
||
| 515 | #=GF WK Tetrahydrofolate_riboswitch |
||
| 516 | .. |
||
| 517 | AAQK01002704.1/947-1059 -U-GC-AAAAUAGGUUUCCAUGC.. |
||
| 518 | #=GC SS_cons .(.((.((----((((((((((... |
||
| 519 | #=GC RF .g.gc.aGAGUAGggugccgugc.. |
||
| 520 | // |
||
| 521 | |||
| 522 | """ |
||
| 523 | nalign = '' |
||
| 524 | for l in self.lines: |
||
| 525 | if l.startswith('//'): |
||
| 526 | nalign += l + '\n' |
||
| 527 | if l.startswith('#'): |
||
| 528 | nalign += l + '\n' |
||
| 529 | else: |
||
| 530 | for i in ids: |
||
| 531 | if l.startswith(i): |
||
| 532 | nalign += l + '\n' |
||
| 533 | |||
| 534 | tf = tempfile.NamedTemporaryFile(delete=False) |
||
| 535 | tf.name += '.stk' |
||
| 536 | print('Saved to ', tf.name) |
||
| 537 | if verbose: |
||
| 538 | print(nalign) |
||
| 539 | f = open(tf.name, 'w') |
||
| 540 | f.write(nalign) |
||
| 541 | #f.write(self.rf + '\n') |
||
| 542 | f.close() |
||
| 543 | return RNAalignment(tf.name) |
||
| 544 | |||
| 545 | def __add__(self, rna_seq): |
||
| 546 | self.seqs.append(rna_seq) |
||
| 547 | self.reload_alignment() |
||
| 548 | |||
| 549 | def write(self, fn, verbose=False): |
||
| 550 | """Write the alignment to a file""" |
||
| 551 | if verbose: |
||
| 552 | print('Save to ', fn) |
||
| 553 | with open(fn, 'w') as f: |
||
| 554 | f.write('# STOCKHOLM 1.0\n') |
||
| 555 | shift = max([len(x) for x in [s.id for s in self.seqs] + ['#=GC=SS_cons']]) |
||
| 556 | for s in self: |
||
| 557 | f.write(s.id.ljust(shift + 2, ' ') + s.seq + '\n') |
||
| 558 | f.write('#=GC SS_cons'.ljust(shift + 2, ' ') + self.ss_cons + '\n') |
||
| 559 | f.write('//') |
||
| 560 | |||
| 561 | def copy_ss_cons_to_all(self, verbose=False): |
||
| 562 | for s in self.io: |
||
| 563 | if verbose: |
||
| 564 | self.ss_cons |
||
| 565 | self.io[0].seq |
||
| 566 | try: |
||
| 567 | s.letter_annotations['secondary_structure'] = self.ss_cons |
||
| 568 | except TypeError: |
||
| 569 | raise Exception( |
||
| 570 | 'Please check if all your sequences and ss lines are of the same length!') |
||
| 571 | s.ss = self.ss_cons |
||
| 572 | s.ss_clean = self.get_clean_ss(s.ss) |
||
| 573 | s.seq_nogaps = str(s.seq).replace('-', '') |
||
| 574 | s.ss_nogaps = self.get_ss_remove_gaps(s.seq, s.ss_clean) |
||
| 575 | |||
| 576 | def copy_ss_cons_to_all_editing_sequence(self, seq_id, before, after): |
||
| 577 | """Change a sequence's sec structure. |
||
| 578 | |||
| 579 | :param seq_id: string, sequence id to change, eg: ``AE009948.1/1094322-1094400`` |
||
| 580 | :param before: string, character to change from, eg: ``,`` |
||
| 581 | :param after: string, character to change to, eg: ``.`` |
||
| 582 | |||
| 583 | .. warning:: before and after has to be one character long |
||
| 584 | """ |
||
| 585 | for s in self.io: |
||
| 586 | if s.id == seq_id: |
||
| 587 | s.letter_annotations['secondary_structure'] = self.ss_cons.replace(before, after) |
||
| 588 | else: |
||
| 589 | s.letter_annotations['secondary_structure'] = self.ss_cons |
||
| 590 | |||
| 591 | def get_ss_remove_gaps(self, seq, ss): |
||
| 592 | """ |
||
| 593 | :param seq: string, sequence |
||
| 594 | :param ss: string, ss |
||
| 595 | |||
| 596 | UAU-AACAUAUAAUUUUGACAAUAUGG-GUCAUAA-GUUUCUACCGGAAUACC--GUAAAUAUUCU---GACUAUG-UAUA- |
||
| 597 | (((.(.((((,,,(((((((_______.))))))).,,,,,,,,(((((((__.._____))))))...),,)))).)))). |
||
| 598 | """ |
||
| 599 | nss = '' |
||
| 600 | for i, j in zip(seq, ss): |
||
| 601 | if i != '-': |
||
| 602 | nss += j |
||
| 603 | return nss |
||
| 604 | |||
| 605 | def plot(self, plot_fn='rchie.png'): |
||
| 606 | return RChie().plot_cov(self.io.format("fasta"), self.ss_cons_std, plot_fn) |
||
| 607 | |||
| 608 | def get_ss_cons_pk(self): |
||
| 609 | """ |
||
| 610 | :return: SS_cons_pk line or None if there is now SS_cons_pk:""" |
||
| 611 | ss_cons_pk = '' |
||
| 612 | for l in self.lines: |
||
| 613 | if l.startswith('#=GC SS_cons_pk'): |
||
| 614 | ss_cons_pk += l.replace('#=GC SS_cons_pk', '').strip() |
||
| 615 | return ss_cons_pk |
||
| 616 | |||
| 617 | def get_ss_cons(self): |
||
| 618 | """ |
||
| 619 | :return: SS_cons_pk line or None if there is now SS_cons_pk. |
||
| 620 | """ |
||
| 621 | ss_cons = '' |
||
| 622 | for l in self.lines: |
||
| 623 | if '#=GC SS_cons' in l and '#=GC SS_cons_pk' not in l: |
||
| 624 | ss_cons += l.replace('#=GC SS_cons', '').strip() |
||
| 625 | return ss_cons |
||
| 626 | |||
| 627 | @property |
||
| 628 | def ss_cons_with_pk(self): |
||
| 629 | """go over ss_cons and overwrite bp is there is pk (ss_cons_pk) |
||
| 630 | |||
| 631 | ss_cons: (((.(.((((,,,(((((((_______.))))))).,,,,,,,,(((((((__.._____))))))...),,)))).)))). |
||
| 632 | ss_cons_pk: .......................[[...............................]]........................ |
||
| 633 | ss_cons_with_pk: (((.(.((((,,,(((((((___[[__.))))))).,,,,,,,,(((((((__.._]]__))))))...),,)))).)))). |
||
| 634 | |||
| 635 | "return ss_cons_with_pk: string, e.g. (((.(.((((,,,(((((((___[[__.))))""" |
||
| 636 | if self.ss_cons_pk: |
||
| 637 | ss_cons_with_pk = '' |
||
| 638 | for i, (s, p) in enumerate(zip(self.ss_cons, self.ss_cons_pk)): |
||
| 639 | if p != '.': |
||
| 640 | ss_cons_with_pk += p |
||
| 641 | else: |
||
| 642 | ss_cons_with_pk += s |
||
| 643 | return ss_cons_with_pk |
||
| 644 | else: |
||
| 645 | return self.ss_cons |
||
| 646 | |||
| 647 | @property |
||
| 648 | def ss_cons_with_pk_std(self): |
||
| 649 | if self.ss_cons_pk: |
||
| 650 | ss_cons_with_pk_std = '' |
||
| 651 | for i, (s, p) in enumerate(zip(get_rfam_ss_notat_to_dot_bracket_notat(self.ss_cons), self.ss_cons_pk)): |
||
| 652 | if p != '.': |
||
| 653 | ss_cons_with_pk_std += p |
||
| 654 | else: |
||
| 655 | ss_cons_with_pk_std += s |
||
| 656 | return ss_cons_with_pk_std |
||
| 657 | else: |
||
| 658 | return self.ss_cons |
||
| 659 | |||
| 660 | def get_gc_rf(self): |
||
| 661 | """Return (str) ``#=GC RF`` or '' if this line is not in the alignment. |
||
| 662 | """ |
||
| 663 | for l in self.lines: |
||
| 664 | if l.startswith('#=GC RF'): |
||
| 665 | return l.replace('#=GC RF', '').replace('_cons', '').strip() |
||
| 666 | else: |
||
| 667 | return '' |
||
| 668 | # raise RNAalignmentError('There is on #=GC RF in the alignment!') |
||
| 669 | |||
| 670 | def get_shift_seq_in_align(self): |
||
| 671 | """RF_cons vs '#=GC RF' ???""" |
||
| 672 | for l in self.lines: |
||
| 673 | if l.startswith('#=GC RF'): |
||
| 674 | # #=GC RF .g.gc.a |
||
| 675 | l = l.replace('#=GC RF', '') |
||
| 676 | c = 7 # 12 # len of '#=GC RF' |
||
| 677 | # .g.gc.a |
||
| 678 | for i in l: |
||
| 679 | if i == ' ': |
||
| 680 | c += 1 |
||
| 681 | self.shift = c |
||
| 682 | return c |
||
| 683 | |||
| 684 | def map_seq_on_seq(self, seq_id, seq_id_target, resis, v=True): |
||
| 685 | """ |
||
| 686 | :param seq_id: seq_id, 'AAML04000013.1/228868-228953' |
||
| 687 | :param seq_id_target: seq_id of target, 'CP000721.1/2204691-2204778' |
||
| 688 | :param resis: list resis, [5,6] |
||
| 689 | |||
| 690 | map:: |
||
| 691 | |||
| 692 | [4, 5, 6] |
||
| 693 | UAU-A |
||
| 694 | UAU-AA |
||
| 695 | UAU-AAC |
||
| 696 | [5, 6, 7] |
||
| 697 | CAC-U |
||
| 698 | CAC-U- |
||
| 699 | CAC-U-U |
||
| 700 | [4, None, 5] |
||
| 701 | |||
| 702 | """ |
||
| 703 | # get number for first seq |
||
| 704 | print(resis) |
||
| 705 | nresis = [] |
||
| 706 | for s in self.io: |
||
| 707 | if s.id.strip() == seq_id.strip(): |
||
| 708 | for i in resis: |
||
| 709 | print(s.seq[:i + 1]) # UAU-A |
||
| 710 | nresis.append(i + s.seq[:i].count('-')) |
||
| 711 | print(nresis) |
||
| 712 | |||
| 713 | print(self.map_seq_on_align(seq_id_target, nresis)) |
||
| 714 | return |
||
| 715 | |||
| 716 | resis_target = [] |
||
| 717 | for s in self.io: |
||
| 718 | if s.id.strip() == seq_id_target.strip(): |
||
| 719 | for i in nresis: |
||
| 720 | if v: |
||
| 721 | print(s.seq[:i]) |
||
| 722 | if s.seq[i - 1] == '-': |
||
| 723 | resis_target.append(None) |
||
| 724 | else: |
||
| 725 | resis_target.append(i - s.seq[:i].count('-')) |
||
| 726 | return resis_target |
||
| 727 | |||
| 728 | def map_seq_on_align(self, seq_id, resis, v=True): |
||
| 729 | """ |
||
| 730 | :param seqid: seq_id, 'CP000721.1/2204691-2204775' |
||
| 731 | :param resis: list resis, [5,6] |
||
| 732 | |||
| 733 | maps:: |
||
| 734 | |||
| 735 | [5, 6, 8] |
||
| 736 | CAC-U |
||
| 737 | CAC-U- |
||
| 738 | CAC-U-UA |
||
| 739 | [4, None, 6] |
||
| 740 | |||
| 741 | """ |
||
| 742 | if v: |
||
| 743 | print(resis) |
||
| 744 | nresis = [] |
||
| 745 | for s in self.io: |
||
| 746 | if s.id.strip() == seq_id.strip(): |
||
| 747 | for i in resis: |
||
| 748 | if v: |
||
| 749 | print(s.seq[:i]) |
||
| 750 | if s.seq[i - 1] == '-': |
||
| 751 | nresis.append(None) |
||
| 752 | else: |
||
| 753 | nresis.append(i - s.seq[:i].count('-')) |
||
| 754 | return nresis |
||
| 755 | |||
| 756 | def head(self): |
||
| 757 | return '\n'.join(self.lines[:5]) |
||
| 758 | |||
| 759 | def tail(self): |
||
| 760 | return '\n'.join(self.lines[-5:]) |
||
| 761 | |||
| 762 | def describe(self): |
||
| 763 | """Describe the alignment. |
||
| 764 | |||
| 765 | > print(a.describe()) |
||
| 766 | SingleLetterAlphabet() alignment with 13 rows and 82 columns |
||
| 767 | |||
| 768 | """ |
||
| 769 | return str(self.io).split('\n')[0] |
||
| 770 | |||
| 771 | def remove_empty_columns(self, verbose=False): |
||
| 772 | """Remove empty columns in place. |
||
| 773 | |||
| 774 | Example:: |
||
| 775 | |||
| 776 | >>> a = RNAalignment("test_data/zmp.stk") |
||
| 777 | >>> print(a) |
||
| 778 | SingleLetterAlphabet() alignment with 6 rows and 319 columns |
||
| 779 | ---ACCUUGCGCGACUGGCGAAUCC-------------------...AAU CP001644.1/756294-756165 |
||
| 780 | --GCUCUCGCGCGACUGGCGACUUUG------------------...GAA CU234118.1/352539-352459 |
||
| 781 | UGAGUUUUCUGCGACUGACGGAUUAU------------------...CUG BAAV01000055.1/2897-2982 |
||
| 782 | GCCCGUUCGCGUGACUGGCGCUAGU-------------------...CGA CP000927.1/5164264-5164343 |
||
| 783 | -----GGGUCGUGACUGGCGAACA--------------------...--- zmp |
||
| 784 | UCACCCCUGCGUGACUGGCGAUA---------------------...GUU AP009385.1/718103-718202 |
||
| 785 | >>> a.remove_empty_columns() |
||
| 786 | >>> print(a) |
||
| 787 | SingleLetterAlphabet() alignment with 6 rows and 138 columns |
||
| 788 | ---ACCUUGCGCGACUGGCGAAUCC-UGAAGCUGCUUUG-AGCG...AAU CP001644.1/756294-756165 |
||
| 789 | --GCUCUCGCGCGACUGGCGACUUUG------------------...GAA CU234118.1/352539-352459 |
||
| 790 | UGAGUUUUCUGCGACUGACGGAUUAU------------------...CUG BAAV01000055.1/2897-2982 |
||
| 791 | GCCCGUUCGCGUGACUGGCGCUAGU-------------------...CGA CP000927.1/5164264-5164343 |
||
| 792 | -----GGGUCGUGACUGGCGAACA--------G-----------...--- zmp |
||
| 793 | UCACCCCUGCGUGACUGGCGAUA--------GAACCCUCGGGUU...GUU AP009385.1/718103-718202 |
||
| 794 | |||
| 795 | go over all seq |
||
| 796 | modifes self.nss_cons""" |
||
| 797 | cols_to_rm = [] |
||
| 798 | |||
| 799 | # get only seqs |
||
| 800 | for i in range(len(self[0])): |
||
| 801 | gap = True |
||
| 802 | for seq in self: |
||
| 803 | if seq.seq[i] != '-': |
||
| 804 | gap = False |
||
| 805 | if gap: |
||
| 806 | cols_to_rm.append(i) |
||
| 807 | |||
| 808 | # remove from sequences |
||
| 809 | for s in self: |
||
| 810 | s.remove_columns(cols_to_rm) |
||
| 811 | |||
| 812 | # update io # hack # |
||
| 813 | tmpfn = tempfile.NamedTemporaryFile(delete=False).name |
||
| 814 | self.write(tmpfn, verbose=False) |
||
| 815 | self.io = AlignIO.read(tmpfn, "stockholm") |
||
| 816 | |||
| 817 | # nss_cons update |
||
| 818 | nss_cons = '' |
||
| 819 | for i, s in enumerate(self.ss_cons): |
||
| 820 | if i not in cols_to_rm: |
||
| 821 | nss_cons += s |
||
| 822 | self.ss_cons = nss_cons |
||
| 823 | |||
| 824 | def format_annotation(self, t): |
||
| 825 | return self.shift * ' ' + t |
||
| 826 | |||
| 827 | def find_core(self, ids=None): |
||
| 828 | """Find common core for ids. |
||
| 829 | |||
| 830 | .. image:: ../pngs/find_core.png |
||
| 831 | Fig. By core, we understand columns that have all homologous residues. The core is here marked by `x`. |
||
| 832 | |||
| 833 | :param id: list, ids of seq in the alignment to use |
||
| 834 | """ |
||
| 835 | if not ids: |
||
| 836 | ids = [] |
||
| 837 | for s in self.io: |
||
| 838 | ids.append(s.id) |
||
| 839 | |||
| 840 | xx = list(range(0, len(self.io[0]))) |
||
| 841 | for i in range(0, len(self.io[0])): # if . don't use it |
||
| 842 | for s in self.io: |
||
| 843 | # print s.id |
||
| 844 | if s.id in ids: |
||
| 845 | if s.seq[i] == '-': |
||
| 846 | xx[i] = '-' |
||
| 847 | break |
||
| 848 | else: |
||
| 849 | xx[i] = 'x' |
||
| 850 | |||
| 851 | return ''.join(xx) |
||
| 852 | shift = self.get_shift_seq_in_align() |
||
| 853 | |||
| 854 | fnlist = open(self.fn).read().strip().split('\n') |
||
| 855 | fnlist.insert(-2, 'x' + ' ' * (shift - 1) + ''.join(xx)) |
||
| 856 | # print fnlist |
||
| 857 | for l in fnlist: |
||
| 858 | print(l) |
||
| 859 | |||
| 860 | def find_seq(self, seq, verbose=False): |
||
| 861 | """Find seq (also subsequences) and reverse in the alignment. |
||
| 862 | |||
| 863 | Args: |
||
| 864 | |||
| 865 | seq (str): seq is upper() |
||
| 866 | verbose (bool): be verbose |
||
| 867 | |||
| 868 | :: |
||
| 869 | |||
| 870 | seq = "ggaucgcugaacccgaaaggggcgggggacccagaaauggggcgaaucucuuccgaaaggaagaguaggguuacuccuucgacccgagcccgucagcuaaccucgcaagcguccgaaggagaauc" |
||
| 871 | hit = a.find_seq(seq, verbose=False) |
||
| 872 | ggaucgcugaacccgaaaggggcgggggacccagaaauggggcgaaucucuuccgaaaggaagaguaggguuacuccuucgacccgagcccgucagcuaaccucgcaagcguccgaaggagaauc |
||
| 873 | Match: AL939120.1/174742-174619 |
||
| 874 | ID: AL939120.1/174742-174619 |
||
| 875 | Name: AL939120.1 |
||
| 876 | Description: AL939120.1/174742-174619 |
||
| 877 | Number of features: 0 |
||
| 878 | /start=174742 |
||
| 879 | /end=174619 |
||
| 880 | /accession=AL939120.1 |
||
| 881 | Per letter annotation for: secondary_structure |
||
| 882 | Seq('CCAGGUAAGUCGCC-G-C--ACCG---------------GUCA-----------...GGA', SingleLetterAlphabet()) |
||
| 883 | GGAUCGCUGAACCCGAAAGGGGCGGGGGACCCAGAAAUGGGGCGAAUCUCUUCCGAAAGGAAGAGUAGGGUUACUCCUUCGACCCGAGCCCGUCAGCUAACCUCGCAAGCGUCCGAAGGAGAAUC |
||
| 884 | |||
| 885 | """ |
||
| 886 | seq = seq.replace('-', '').upper() |
||
| 887 | for s in self.io: |
||
| 888 | seq_str = str(s.seq).replace('-', '').upper() |
||
| 889 | if verbose: |
||
| 890 | print(seq_str) |
||
| 891 | if seq_str.find(seq) > -1 or seq.find(seq_str) > -1: |
||
| 892 | print('Match:', s.id) |
||
| 893 | print(s) |
||
| 894 | print(seq) |
||
| 895 | return s |
||
|
|
|||
| 896 | print('Not found') |
||
| 897 | |||
| 898 | def find_seq_exact(self, seq, verbose=False): |
||
| 899 | """Find seq (also subsequences) and reverse in the alignment. |
||
| 900 | |||
| 901 | :param seq: string, seq, seq is upper() |
||
| 902 | :param verbose: boolean, be verbose or not |
||
| 903 | """ |
||
| 904 | seq = seq.replace('-', '').upper() |
||
| 905 | for s in self.io: |
||
| 906 | seq_str = str(s.seq).replace('-', '').upper() |
||
| 907 | if verbose: |
||
| 908 | print(seq_str) |
||
| 909 | if seq_str == seq: |
||
| 910 | print('Match:', s.id) |
||
| 911 | print(s) |
||
| 912 | print(seq) |
||
| 913 | return s |
||
| 914 | print('Not found') |
||
| 915 | |||
| 916 | def get_clean_ss(self, ss): |
||
| 917 | nss = '' |
||
| 918 | for s in ss: |
||
| 919 | nss += get_rfam_ss_notat_to_dot_bracket_notat(s) |
||
| 920 | return nss |
||
| 921 | |||
| 922 | def get_seq_ss(self, seq_id): # seq,ss): |
||
| 923 | s = self.get_seq(seq_id).seq |
||
| 924 | # print seq, ss |
||
| 925 | # new |
||
| 926 | nseq = '' |
||
| 927 | nss = '' |
||
| 928 | for i, j in zip(seq, ss): |
||
| 929 | if i != '-': # gap |
||
| 930 | # print i,j |
||
| 931 | nseq += i |
||
| 932 | nss += get_rfam_ss_notat_to_dot_bracket_notat(j) |
||
| 933 | return nseq.strip(), nss.strip() |
||
| 934 | |||
| 935 | def get_seq(self, seq_id): |
||
| 936 | for s in self.io: |
||
| 937 | if s.id == seq_id: |
||
| 938 | return s |
||
| 939 | raise Exception('Seq not found') |
||
| 940 | |||
| 941 | def get_seq_with_name(self, seq_name): |
||
| 942 | for s in self.io: |
||
| 943 | if s.name == seq_name: |
||
| 944 | return s |
||
| 945 | raise Exception('Seq not found') |
||
| 946 | |||
| 947 | def align_seq(self, seq): |
||
| 948 | """Align seq to the alignment. |
||
| 949 | |||
| 950 | Using self.rf. |
||
| 951 | |||
| 952 | Args: |
||
| 953 | |||
| 954 | seq (str): sequence, e.g. ``-GGAGAGUA-GAUGAUUCGCGUUAAGUGUGUGUGA-AUGGGAUGUC...`` |
||
| 955 | |||
| 956 | Returns: |
||
| 957 | |||
| 958 | str: seq that can be inserted into alignemnt, ``.-.GG.AGAGUA-GAUGAUUCGCGUUA`` ! . -> - |
||
| 959 | """ |
||
| 960 | seq = list(seq) |
||
| 961 | seq.reverse() |
||
| 962 | nseq = '' |
||
| 963 | for n in self.rf: # n nuclotide |
||
| 964 | if n != '.': |
||
| 965 | try: |
||
| 966 | j = seq.pop() |
||
| 967 | except: |
||
| 968 | j = '.' |
||
| 969 | nseq += j |
||
| 970 | if n == '.': |
||
| 971 | nseq += '.' # + j |
||
| 972 | return nseq.replace('.', '-') |
||
| 973 | |||
| 974 | def __repr__(self): |
||
| 975 | return (str(self.io)) |
||
| 976 | |||
| 977 | def trimmed_rf_and_ss(self): |
||
| 978 | """Remove from RF and SS gaps. |
||
| 979 | |||
| 980 | Returns: |
||
| 981 | |||
| 982 | (str,str): trf, tss - new RF and SS |
||
| 983 | |||
| 984 | """ |
||
| 985 | trf = '' |
||
| 986 | tss = '' |
||
| 987 | for r, s in zip(self.rf, self.ss_cons_std): |
||
| 988 | if r not in ['-', '.']: |
||
| 989 | trf += r |
||
| 990 | tss += s |
||
| 991 | return trf, tss |
||
| 992 | |||
| 993 | def get_distances(self): |
||
| 994 | """Get distances (seq identity) all-vs-all. |
||
| 995 | |||
| 996 | With BioPython. |
||
| 997 | |||
| 998 | blastn: ``Bad alphabet 'U' in sequence 'AE008922.1/409481-409568' at position '7'`` only for DNA? |
||
| 999 | |||
| 1000 | read more (also about matrix at <http://biopython.org/wiki/Phylo> and |
||
| 1001 | HTTP://biopython.org/DIST/docs/api/Bio.Phylo.TreeConstruction.DistanceCalculator-class.html |
||
| 1002 | """ |
||
| 1003 | calculator = DistanceCalculator('identity') |
||
| 1004 | dm = calculator.get_distance(self.io) |
||
| 1005 | return dm |
||
| 1006 | |||
| 1007 | def get_the_closest_seq_to_ref_seq(self, verbose=False): |
||
| 1008 | """ |
||
| 1009 | |||
| 1010 | Example:: |
||
| 1011 | |||
| 1012 | >>> a = RNAalignment("test_data/RF02221.stockholm.sto") |
||
| 1013 | >>> a.get_the_closest_seq_to_ref_seq() |
||
| 1014 | AF421314.1/431-344 |
||
| 1015 | |||
| 1016 | """ |
||
| 1017 | self + RNASeq('ConSeq', self.rf, '') |
||
| 1018 | dist = self.get_distances() |
||
| 1019 | distConSeq = dist['ConSeq'][:-1] # to remove ending 0, bc of distance to itself |
||
| 1020 | minimal = min(distConSeq) |
||
| 1021 | |||
| 1022 | index = dist['ConSeq'].index(minimal) |
||
| 1023 | #id = dist.names[index] |
||
| 1024 | if verbose: |
||
| 1025 | print('dist:\n', str(dist)) |
||
| 1026 | print('distConSeq:', dist['ConSeq']) |
||
| 1027 | return self[index] |
||
| 1028 | |||
| 1029 | |||
| 1030 | class CMAlign(): |
||
| 1031 | """CMAalign class around cmalign (of Inferal). |
||
| 1032 | |||
| 1033 | cmalign - aligns the RNA sequences in <seqfile> to the covariance model |
||
| 1034 | (CM) in <cmfile>. The new alignment is output to stdout in Stockholm |
||
| 1035 | format. |
||
| 1036 | |||
| 1037 | Example:: |
||
| 1038 | |||
| 1039 | cma = ra.CMAlign() |
||
| 1040 | cma.run_cmalign("ade_seq.fa", "RF00167.cm") |
||
| 1041 | seq = cma.get_seq() |
||
| 1042 | print 'cma hit ', seq |
||
| 1043 | print 'seq ', a.align_seq(seq) |
||
| 1044 | print 'a.rf ', a.rf |
||
| 1045 | |||
| 1046 | cmd cmalign -g RF00167.cm ade_seq.fa |
||
| 1047 | |||
| 1048 | # STOCKHOLM 1.0 |
||
| 1049 | #=GF AU Infernal 1.1.2 |
||
| 1050 | |||
| 1051 | ade ----------------CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAG-CCUUAAA-CUCUUGAUUAUGAAGUGA------------ |
||
| 1052 | #=GR ade PP ................99*********************************************.*******.***************999............ |
||
| 1053 | #=GC SS_cons :::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,)))))))):::::::::::::: |
||
| 1054 | #=GC RF aaaaaauaaaaaaaauucccuCgUAUAAucccgggAAUAUGGcccgggaGUUUCUACCaggcagCCGUAAAcugccuGACUAcGagggaaauuuuuuuuuuu |
||
| 1055 | // |
||
| 1056 | cma hit ----------------CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAG-CCUUAAA-CUCUUGAUUAUGAAGUGA------------ |
||
| 1057 | seq ----------------CGCU-U-CAUAUAAUCCUAAUGAUAUGG-UUUGGGA-GUUUCUACCAAGAG-CC--UUAAA-CUCUU---GAUUAUG-AAGUGA------------- |
||
| 1058 | a.rf aaaaaauaaaaaaaauuccc.u.CgUAUAAucccgggAAUAUGG.cccggga.GUUUCUACCaggcagCC..GUAAAcugccu...GACUAcG.agggaaauuuuuuuuuuu. |
||
| 1059 | |||
| 1060 | Install http://eddylab.org/infernal/ |
||
| 1061 | |||
| 1062 | Cite: Nawrocki and S. R. Eddy, Infernal 1.1: 100-fold faster RNA homology searches, Bioinformatics 29:2933-2935 (2013). """ |
||
| 1063 | |||
| 1064 | def __init__(self, outputfn=None): |
||
| 1065 | """Use run_cmalign or load cmalign output from a file""" |
||
| 1066 | if outputfn: |
||
| 1067 | self.output = open(outputfn).read().strip().split('\n') |
||
| 1068 | |||
| 1069 | View Code Duplication | def run_cmalign(self, seq, cm, verbose=True): |
|
| 1070 | """Run cmalign and process the result. |
||
| 1071 | |||
| 1072 | :param seq: seq string |
||
| 1073 | :param cm: cm fn |
||
| 1074 | |||
| 1075 | Run:: |
||
| 1076 | |||
| 1077 | $ cmalign RF01831.cm 4lvv.seq |
||
| 1078 | # STOCKHOLM 1.0 |
||
| 1079 | #=GF AU Infernal 1.1.2 |
||
| 1080 | |||
| 1081 | 4lvv -GGAGAGUA-GAUGAUUCGCGUUAAGUGUGUGUGA-AUGGGAUGUCG-UCACACAACGAAGC---GAGA---GCGCGGUGAAUCAUU-GCAUCCGCUCCA |
||
| 1082 | #=GR 4lvv PP .********.******************9999998.***********.8999999******8...5555...8**************.************ |
||
| 1083 | #=GC SS_cons (((((----(((((((((((,,,,,<<-<<<<<<<<___________>>>>>>>>>>,,,<<<<______>>>>,,,)))))))))))-------))))) |
||
| 1084 | #=GC RF ggcaGAGUAGggugccgugcGUuAAGUGccggcgggAcGGGgaGUUGcccgccggACGAAgggcaaaauugcccGCGguacggcaccCGCAUcCgCugcc |
||
| 1085 | // |
||
| 1086 | |||
| 1087 | .. warning :: requires cmalign to be set in your shell |
||
| 1088 | """ |
||
| 1089 | tf = tempfile.NamedTemporaryFile(delete=False) |
||
| 1090 | tf.name += '.seq' |
||
| 1091 | |||
| 1092 | with open(tf.name, 'w') as f: |
||
| 1093 | f.write('>target\n') |
||
| 1094 | f.write(seq + '\n') |
||
| 1095 | |||
| 1096 | cmd = 'cmalign -g ' + cm + ' ' + tf.name # global |
||
| 1097 | if verbose: |
||
| 1098 | print('cmd' + cmd) |
||
| 1099 | o = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) |
||
| 1100 | stdout = o.stdout.read().strip() |
||
| 1101 | stderr = o.stderr.read().strip() |
||
| 1102 | if verbose: |
||
| 1103 | print(stdout) |
||
| 1104 | self.output = stdout.split('\n') |
||
| 1105 | |||
| 1106 | def get_gc_rf(self): |
||
| 1107 | """Get ``#=GC RF``. |
||
| 1108 | |||
| 1109 | :var self.output: string |
||
| 1110 | """ |
||
| 1111 | for l in self.output: |
||
| 1112 | if l.startswith('#=GC RF'): |
||
| 1113 | return l.replace('#=GC RF', '').strip() |
||
| 1114 | |||
| 1115 | def get_seq(self): |
||
| 1116 | """ |
||
| 1117 | :var self.output: output of cmalign, string |
||
| 1118 | """ |
||
| 1119 | for l in self.output: |
||
| 1120 | if l.strip(): |
||
| 1121 | if not l.startswith('#'): |
||
| 1122 | # 4lvv -GGAGAGUA-GAUGAU |
||
| 1123 | return l.split()[1].strip() |
||
| 1124 | |||
| 1125 | |||
| 1126 | def clean_seq_and_ss(seq, ss): |
||
| 1127 | nseq = '' |
||
| 1128 | nss = '' |
||
| 1129 | for i, j in zip(seq, ss): |
||
| 1130 | if i != '-': # gap |
||
| 1131 | # print i,j |
||
| 1132 | nseq += i |
||
| 1133 | nss += get_rfam_ss_notat_to_dot_bracket_notat_per_char(j) |
||
| 1134 | return nseq.strip(), nss.strip() |
||
| 1135 | |||
| 1136 | |||
| 1137 | def get_rfam_ss_notat_to_dot_bracket_notat_per_char(c): |
||
| 1138 | """Take (c)haracter and standardize ss (including pks in letter (AAaa) notation). |
||
| 1139 | |||
| 1140 | .. warning:: DD DD will be treated as BB BB (<< >>) (it might be wrong!)""" |
||
| 1141 | if c in [',', '_', ':', '-']: |
||
| 1142 | return '.' |
||
| 1143 | if c == '<': |
||
| 1144 | return '(' |
||
| 1145 | if c == '{': |
||
| 1146 | return '(' |
||
| 1147 | if c == '}': |
||
| 1148 | return ')' |
||
| 1149 | if c == ']': |
||
| 1150 | return ')' |
||
| 1151 | if c == '[': |
||
| 1152 | return '(' |
||
| 1153 | if c == '>': |
||
| 1154 | return ')' |
||
| 1155 | if c == '>': |
||
| 1156 | return ')' |
||
| 1157 | if c == 'A': |
||
| 1158 | return '[' |
||
| 1159 | if c == 'a': |
||
| 1160 | return ']' |
||
| 1161 | if c == 'B': |
||
| 1162 | return '<' |
||
| 1163 | if c == 'b': |
||
| 1164 | return '>' |
||
| 1165 | if c == 'C': |
||
| 1166 | return '{' |
||
| 1167 | if c == 'c': |
||
| 1168 | return '}' |
||
| 1169 | # !!!!!!!!!!!!!!!!!!!!!!!!!! |
||
| 1170 | if c == 'D': |
||
| 1171 | return '<' |
||
| 1172 | if c == 'd': |
||
| 1173 | return '>' |
||
| 1174 | # !!!!!!!!!!!!!!!!!!!!!!!!!! |
||
| 1175 | return c |
||
| 1176 | |||
| 1177 | |||
| 1178 | def get_rfam_ss_notat_to_dot_bracket_notat(ss): |
||
| 1179 | """Change all <<>> to "standard" dot bracket notation. |
||
| 1180 | |||
| 1181 | Works also with pseudknots AA BB CC etc.""" |
||
| 1182 | nss = '' |
||
| 1183 | for s in ss: |
||
| 1184 | ns = get_rfam_ss_notat_to_dot_bracket_notat_per_char(s) |
||
| 1185 | nss += ns |
||
| 1186 | return nss |
||
| 1187 | |||
| 1188 | |||
| 1189 | def fasta2stokholm(fn): |
||
| 1190 | """Take a gapped fasta file and return an RNAalignment object. |
||
| 1191 | |||
| 1192 | A fasta file should look like this:: |
||
| 1193 | |||
| 1194 | >AE009948.1/1094322-1094400 |
||
| 1195 | UAC-U-UAUUUAUGCUGAGGAU--UGG--CUUAGC-GUCUCUACAAGACA-CC--GU-AA-UGUCU---AACAAUA-AGUA- |
||
| 1196 | ... |
||
| 1197 | >CP000721.1/2204691-2204778 |
||
| 1198 | CAC-U-UAUAUAAAUCUGAUAAUAAGG-GUCGGAU-GUUUCUACCAAGCUACC--GUAAAUUGCUAUAGGACUAUA-AGUG- |
||
| 1199 | >SS_cons |
||
| 1200 | (((.(.((((...(((((((........))))))).........(((((((.........))))))...)..)))).)))). |
||
| 1201 | >SS_cons_pk |
||
| 1202 | .........................[[........................]]............................. |
||
| 1203 | |||
| 1204 | ``SS_cons_pk`` in optionally and is an extra line used to define a pseudoknot. You |
||
| 1205 | can also define second psedoknot as ``<<<...>>>`` and the third one with ``{{{ }}}``. |
||
| 1206 | |||
| 1207 | :param fn: file |
||
| 1208 | :return: RNAalignment object |
||
| 1209 | """ |
||
| 1210 | seqs = [] |
||
| 1211 | s = None |
||
| 1212 | for l in open(fn): |
||
| 1213 | if l.startswith('>'): |
||
| 1214 | if s: |
||
| 1215 | seqs.append(s) |
||
| 1216 | s = RNASeq(l.replace('>', '').strip(), '') |
||
| 1217 | else: |
||
| 1218 | s.seq += l.strip() |
||
| 1219 | |||
| 1220 | txt = '' |
||
| 1221 | for l in open(fn): |
||
| 1222 | if l.startswith('>'): |
||
| 1223 | id = '\n' + l.replace('>', '\n').strip() + ' ' |
||
| 1224 | id = re.sub('ss_cons_pk', '#=GC SS_cons_pk', id, flags=re.IGNORECASE) |
||
| 1225 | id = re.sub('ss_cons', '#=GC SS_cons', id, flags=re.IGNORECASE) |
||
| 1226 | txt += id |
||
| 1227 | else: |
||
| 1228 | txt += l.strip() |
||
| 1229 | txt = txt.strip() + '\n' # clean upfront \n and add tailing \n |
||
| 1230 | |||
| 1231 | tf = tempfile.NamedTemporaryFile(delete=False) |
||
| 1232 | tf.name += '.stk' |
||
| 1233 | with open(tf.name, 'w') as f: |
||
| 1234 | f.write('# STOCKHOLM 1.0\n') |
||
| 1235 | f.write(txt) |
||
| 1236 | f.write('//\n') |
||
| 1237 | return RNAalignment(tf.name) |
||
| 1238 | |||
| 1239 | |||
| 1240 | def fetch_stokholm(rfam_acc, dpath=None): |
||
| 1241 | """Fetch Stokholm file from Rfam. |
||
| 1242 | |||
| 1243 | :param rfam_acc: str, Rfam accession number, eg. RF00028 |
||
| 1244 | :param dpath: str or None, if None saves to current location, otherwise save to dpath folder |
||
| 1245 | |||
| 1246 | .. warning :: urllib3 is required, pip install urllib3 |
||
| 1247 | """ |
||
| 1248 | import urllib3 |
||
| 1249 | http = urllib3.PoolManager() |
||
| 1250 | # try: |
||
| 1251 | print(dpath) |
||
| 1252 | response = http.request('GET', url='http://rfam.xfam.org/family/' + rfam_acc.lower() + |
||
| 1253 | '/alignment?acc=' + rfam_acc.lower() + '&format=stockholm&download=1') |
||
| 1254 | # except urllib3.HTTPError: |
||
| 1255 | # raise Exception('The PDB does not exists: ' + pdb_id) |
||
| 1256 | txt = response.data |
||
| 1257 | if dpath is None: |
||
| 1258 | npath = rfam_acc + '.stk' |
||
| 1259 | else: |
||
| 1260 | npath = dpath + os.sep + rfam_acc + '.stk' |
||
| 1261 | print('downloading...' + npath) |
||
| 1262 | with open(npath, 'wb') as f: |
||
| 1263 | f.write(txt) |
||
| 1264 | print('ok') |
||
| 1265 | return rfam_acc + '.stk' |
||
| 1266 | |||
| 1267 | |||
| 1268 | # def test_seq_multilines_alignment() |
||
| 1269 | def test_alignment_with_pk(): |
||
| 1270 | a = RNAalignment('test_data/RF00167.stockholm.sto') |
||
| 1271 | print(a.tail()) |
||
| 1272 | print(a.ss_cons) |
||
| 1273 | print(a.ss_cons_pk) |
||
| 1274 | print(a.ss_cons_with_pk) |
||
| 1275 | |||
| 1276 | print(a[[1, 2]]) |
||
| 1277 | |||
| 1278 | |||
| 1279 | # main |
||
| 1280 | if __name__ == '__main__': |
||
| 1281 | ## a = RNAalignment('test_data/RF00167.stockholm.sto') |
||
| 1282 | # print a.get_shift_seq_in_align() |
||
| 1283 | # print a.map_seq_on_align('CP000721.1/2204691-2204778', [5,6,8]) |
||
| 1284 | # print a.map_seq_on_seq('AAML04000013.1/228868-228953', 'CP000721.1/2204691-2204778', [4,5,6]) |
||
| 1285 | |||
| 1286 | # print(record.letter_annotations['secondary_structure']) |
||
| 1287 | ## seq = a.get_seq('AAML04000013.1/228868-228953') |
||
| 1288 | # print seq.seq |
||
| 1289 | # print seq.ss |
||
| 1290 | # print a.ss_cons |
||
| 1291 | |||
| 1292 | # print 'x' |
||
| 1293 | # for s in a.io: |
||
| 1294 | # print s.seq |
||
| 1295 | # print s.ss_clean #letter_annotations['secondary_structure'] |
||
| 1296 | |||
| 1297 | # for s in a.io: |
||
| 1298 | # print s.seq_nogaps |
||
| 1299 | # print s.ss_nogaps |
||
| 1300 | |||
| 1301 | # a.write('test_output/out.sto') |
||
| 1302 | |||
| 1303 | # a = RNAalignment("/home/magnus/work/rna-evo/rp12/seq/RF00379.stockholm.stk")##_rm85.stk') |
||
| 1304 | # print a.get_seq_ss("AL939120.1/174742-174619") |
||
| 1305 | # subset = a.subset(["AL939120.1/174742-174619", |
||
| 1306 | # "rp12bsubtilis", |
||
| 1307 | # "AAWL01000001.1/57092-56953", |
||
| 1308 | # "CP000612.1/87012-87130", |
||
| 1309 | # "BA000028.3/1706087-1706245"]) |
||
| 1310 | # % cat /var/folders/yc/ssr9692s5fzf7k165grnhpk80000gp/T/tmpTzPenx |
||
| 1311 | # for s in subset: |
||
| 1312 | # print s.seq |
||
| 1313 | # subset.remove_empty_columns() |
||
| 1314 | # subset.write('/home/magnus/out2.stk') |
||
| 1315 | # for s in subset: |
||
| 1316 | # print s.seq |
||
| 1317 | |||
| 1318 | # print 'subset.ss_cons_std:', subset.ss_cons_std |
||
| 1319 | |||
| 1320 | # a = RNAalignment("/home/magnus/work/rna-evo/rp12/seq/RF00379.stockholm.stk")##_rm85.stk') |
||
| 1321 | # a.ss_cons = "::::::::::{{{{,,,<<<_..." |
||
| 1322 | # print a.ss_cons |
||
| 1323 | # print a.ss_cons_std |
||
| 1324 | # print get_rfam_ss_notat_to_dot_bracket_notat(subset.ss_cons) |
||
| 1325 | |||
| 1326 | ## a.ss_cons_std = 'test of setter' |
||
| 1327 | # print a._ss_cons_std |
||
| 1328 | |||
| 1329 | # pass |
||
| 1330 | # slice |
||
| 1331 | |||
| 1332 | ## slices = a.cols[0:10] |
||
| 1333 | # for s in a: |
||
| 1334 | # print s.seq |
||
| 1335 | # add pk |
||
| 1336 | |||
| 1337 | # for s in slices: |
||
| 1338 | # print s, s.seq, s.ss |
||
| 1339 | |||
| 1340 | #a = fasta2stokholm('test_output/ade_gapped.fa') |
||
| 1341 | # print a |
||
| 1342 | |||
| 1343 | #a = RNAalignment('test_data/RF00001.blocked.stk') |
||
| 1344 | # print a |
||
| 1345 | # print a.ss_cons |
||
| 1346 | # a.plot('rchie.png') |
||
| 1347 | |||
| 1348 | # a = RNAalignment("test_data/RF02221.stockholm.sto") |
||
| 1349 | ## a = RNAalignment('test_data/test_data/RF02221.stockholm.sto') |
||
| 1350 | ## a + RNASeq('ConSeq', '-A-GU-AGAGUA-GGUCUUAUACGUAA-----------------AGUG-UCAUCGGA-U-GGGGAGACUUCCGGUGAACGAA-G-G-----------------------------GUUA---------------------------CCGCGUUAUAUGAC-C-GCUUCCG-CUA-C-U-','') |
||
| 1351 | ## dist = a.get_distances() |
||
| 1352 | # distConSeq = dist['ConSeq'][:-1] # to remove ending 0, bc of distance to itself |
||
| 1353 | ## minimal = min(distConSeq) |
||
| 1354 | ## index = dist['ConSeq'].index(minimal) |
||
| 1355 | # print(dist.names[index]) |
||
| 1356 | |||
| 1357 | a = RNAalignment("test_data/dist_test2.stk") |
||
| 1358 | rep = a.get_the_closest_seq_to_ref_seq() |
||
| 1359 | rep.remove_gaps() |
||
| 1360 | print(rep) |
||
| 1361 | print(rep.ss) |
||
| 1362 | print(rep.seq) |
||
| 1363 | |||
| 1364 | # a.write('tmp.stk') |
||
| 1365 | # s.remove_gaps() |
||
| 1366 | # print(s.seq) |
||
| 1367 | # print(s.ss) |
||
| 1368 | |||
| 1369 | import doctest |
||
| 1370 | doctest.testmod() |
||
| 1371 |